Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0365
Clone ID XT0365
Vector pGT0lxf
Project sanger

Sequence tag XT0365
Sequence
GGTTGTTAGTTCCAAAGGATTTTTTTTTTTGGTGGTGAGCTCTAAAAGATGGTTTTTTTTGGTTGTGAGCTCTTCNAGAT
GGTTTTTTTTGGTTGTGAGCTCTTCTAGATGGTTTTTTTTGGTTGTGAGGCTTTCTAGATGGTTTTTACTAGCAATGTTT
TATGAAGGACTCAAGATAGCCCGAGAGGGTCTGCTTCGAAAGTCTCAAGTCAGCATTCGCTACGAATTCCATGCCTGTCC
CAGGACCTAATGGAACCATCCTAATGGAGACACACGAAACTGTTGGGCCTGCCAGATGCTGAGCTTCCCCC
Sequence Type mRNA
Unitrap ID UNI2162

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 62048904..62049654 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066150 (Slc31a1) NM_175090 solute carrier family 31, member 1 Gene [Source:MGI (curated);Acc:Slc31a1-001]

 
Come back to gene ENSMUSG00000066150


For any suggestions or comments, please send an email to unitrap@crg.es