Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_209C2-3
Clone ID CMHD-GT_209C2-3
Vector pGTlox4
Project cmhd

Sequence tag CMHD-GT_209C2-3
Sequence
AGATGCAGCCAAGCATTTTGTTCTACTCCTAAGGATGTGACTTATAGGGAACTAAAAAGCCTACTGAACTCCAAAGACAT
TATGTTAATTGATGTTAGAAATACATGGGAAATTCTTGAGCAAGGAAAAATACCTGGATCAATCAACATACCATTGGATG
AGGTAGGTGAAGCTCTGCAGATGAACCCAGTGGACTTCAAAGAGAAGTACTGTCAAGTGAAGCCATCCAAATCTGACCGT
CTGCTGTTCTCTTGTTTTAGCTGGAGTGAGAAGTAAGAAGGCTATGGACACAGCAATATCACTGGGGCTTTACAGTGCTC
AACATTATGCTGG
Sequence Type mRNA
Unitrap ID UNI13893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21685605..21686923 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028251 (2610029I01Rik) RIKEN cDNA 2610029I01 gene Gene [Source:MGI Symbol;Acc:MGI:1924282]

 
Come back to gene ENSMUSG00000028251


For any suggestions or comments, please send an email to unitrap@crg.es