Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13613H2
Clone ID IST13613H2
Vector VICTR74
Project tigm

Sequence tag IST13613H2HMR1
Sequence
TGAGGACTCTAAACTCAAGTAGAACAAATCCCTTCTTGGTCTTCTGGGACCNCTAGAGGTCACCGTGTCCAGTCCTTTGC
CTCACCCCCACTGCCCCAGTCTGTATGCACTGAAAAACGTCGGGTTCTGGGTCTACAAAGCCCCTGCTGCCTGTGTTTGA
GGTCTGGAAGGGAGATTTGAGGAAAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AGAGNNAN
Sequence Type genomic DNA
Unitrap ID UNI33908

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4876223..4876466 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035285 (Nat14) NM_201355 N-acetyltransferase 14 Gene [Source:MGI Symbol;Acc:MGI:3039561]


Sequence tag IST13613H2HMF1
Sequence
GTAGCCAGTGCCTTCTGCTGCTTCTTCAGCTCTAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 45428766..45428804 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96487462..96487500 37
NO GENE  

 
Come back to gene ENSMUSG00000035285


For any suggestions or comments, please send an email to unitrap@crg.es