Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_209A4-3
Clone ID CMHD-GT_209A4-3
Vector pGTlox4
Project cmhd

Sequence tag CMHD-GT_209A4-3
Sequence
CCAACACGCACAGACCCACACACATCCACGAGTCCTTTGTGCAGTGGGCACATTACGCAGCGAGATGACGGGCACACAGA
GCAAGGACAGGAAGCCCTGCAGCACCTGTGACTGTACCTCTGCCTGTACTGCCTGCCACCAGCTCGAGGTGGCGGCCGCC
TCATCATCAGTTCCTCAAACGAACTGTCTGCTTTGAGGACTGATGACGAAAAACTGATGCCAAATTTGAAAGAAGTGTTT
TATTTATCTGCAGGGCTACCCAGTTTATACTCAATGCCTCGAAACCCTTAGGACCTCTATTTAATAAGATGAGGATATGA
AACCAGACCACATTAATTTCAGTTAACAGGCTTTCTAAGCTGAACACTTCGCCACTATCATAGCTGTTTGACTCCTAGTT
TTGTTTGTTTTCCTTA
Sequence Type mRNA
Unitrap ID UNI13894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124943407..124943818 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029392 (Rilpl1) NM_021430 Rab interacting lysosomal protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1922945]

 
Come back to gene ENSMUSG00000029392


For any suggestions or comments, please send an email to unitrap@crg.es