Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12503H12
Clone ID IST12503H12
Vector VICTR76
Project tigm

Sequence tag IST12503H12HMF1
Sequence
AGACAAAAAGGGACTTTCATCTTCCCAGCTATCCTTGAAATCTCTGGCCCACACAGATCTTTAAGAATGTGTGCTGCAGG
GGCTGGAGAGAGATGGCTCANTGGTTGANANCNCTGGCTGCTCTTCCANAGGACCTGGNTTTAATTCNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12503H12BBF1
Sequence
AGACAAAAAGGGACTTTCATCTTCCCAGCTATCCTTGAAATCTCTGGCCCACACAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33023424..33023483 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]

 
Come back to gene ENSMUSG00000040183


For any suggestions or comments, please send an email to unitrap@crg.es