Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_208F11-3
Clone ID CMHD-GT_208F11-3
Vector pGTlox4*
Project cmhd

Sequence tag CMHD-GT_208F11-3
Sequence
AGATGAACTTTGAGTCTTTCGTAAAAGATCTTCTTCTGGTTCGCCAGTATCGAGTTGAAGTTTATAAGAATAAAGCTGGA
AATAAGGCGTCTAAGGAGAATGAGTGGTATCTGGCATTTAAGGCTTCTCGCGGCTATCTTTCTCAGATTGAAGACATCCT
GTCTGGTATCATTGACATGTCAGCTTCCGTTGGCGTGATGGGTATTAAAATGGCCGAGGTTGATGGTCATAGACATGTTG
GAGTTGGGTATGTGGATTCCACCCAGAGGAAGCTAGGCTTGTGTGAGTTCCGCGAGAATGATCAGTTCTCTAATCTCGNA
GCTCTTCTGATTCAGATTGGACCAAAAGAATGCGTTTTACCAGGAGGAGAGACTACTGGAGACATGGGGAAACTGAAGGC
AGTTATCCAGA
Sequence Type mRNA
Unitrap ID UNI13895

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88077581..88079421 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024151 (Msh2) NM_008628 mutS homolog 2 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:101816]

 
Come back to gene ENSMUSG00000024151


For any suggestions or comments, please send an email to unitrap@crg.es