Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_206H5-3
Clone ID CMHD-GT_206H5-3
Vector pGTlox4
Project cmhd

Sequence tag CMHD-GT_206H5-3
Sequence
TCTCCAAGAAGGACTCCAGAGAAAGAGGCCATGAGCCAGCCCCTAGCTGGACAGAGGAGAAGATTCCAGAAGCCCAAACC
ACTCCTGCGTTGTGTAAGGACCGGAGGACAATGGCCTGGGCACAGGGCTCACCCTGGAGAGCCACAAGGACCCATCTAGC
CATCCAGGCCTAGCTGGCCAGGGACAAGGCAGAAATTCTAGAAAACCAAAGACTATTTTTGAAAGTGTGTGTGTGTGTCT
GTGTGTCTGTGTGAATGTAGTATGTGAG
Sequence Type mRNA
Unitrap ID UNI13870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 151974524..151974791 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068079 (Tcf15) NM_009328 transcription factor 15 Gene [Source:MGI (curated);Acc:Tcf15-001]

 
Come back to gene ENSMUSG00000068079


For any suggestions or comments, please send an email to unitrap@crg.es