Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14156C5
Clone ID IST14156C5
Vector VICTR74
Project tigm

Sequence tag IST14156C5HMF1
Sequence
GTCNCCAGGTCAGAAGCCNGTGAGAACCTTGGANAATAAAAACTCCCCTGAGCGGGCTGGAGCCGCGCGTGCCTAGCATG
AGCCCGCCCATGGGTTTGACTGGCACCCAGAACCCCTCCCGCAAAAGGACACTAAAGANCACTGGCTGCTCTTTCCGAGA
ACTGAGGTTTGATTTCTAGCACCCACATAGTGGCTCACAACCACCTATAACTCTAGGGGANCCAATGCCTTCTTCNGN
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30916306..30916540 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14156C5BBF1
Sequence
GTCACCAGGTCAGAAGCCAGTGAGAACCTTGGAGAATAAAAACTCCCCTGAGCGGGCTNNNNNNGCGCGTGCCTAGCATG
AGCCCGCCCATGGGTTTGACTGGCACCCAGAACCCCTCCCGCAAAAGGACACTAAAGAGCACTGGCTGCTCTTTCCGAGA
ACTGAGGTTTGATTTCTAGCACCCACATAGTGGCTCACAACCACCTATAACTCTAGGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30916319..30916540 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14156C5HMR1
Sequence
GTGACCTTAACCCGAGTCCCACTTTCCCCACACCCACACGTTCCAGTCTTGCTGGGCAGGCCAAGGGGACAGTCCTGGTG
GCTTCCTTTATTTTCTTCCCTATTCATGAGCAAATGTCACCAAATATTTCCAAGTGTTTCCTTATTCCCTGGGGCTTTTC
GGTCCAGTATGGCCGGAGTCTTCTCAGCTAACCCAGGCAGGTTTCANCCACCACCTTTTTCCCCTTCGCTGGCAGCCTGG
CTGCTCCTCCTANCCATATGTTCAGCTAACCTGGGAGGGTTTCANCCACCACCTTCTTCCCCTTTGCGGGCGAGGAGGCC
TGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30916536..30916859 318
 
EST/CDNA Est Name
  CO431220.1 - CB523244.1 - BY090554.1

 
Come back to gene CO431220.1 - CB523244.1 - BY090554.1


For any suggestions or comments, please send an email to unitrap@crg.es