Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10439A3
Clone ID IST10439A3
Vector VICTR76
Project tigm

Sequence tag IST10439A3HMR1
Sequence
GCCCAGACTGCCATATGCTGGCCTACTTGCACCATGTGCTGGGTGCTGACACTGGTACAAACGCATCAGGTACCCAGGGA
TATGGAAGTGGAATTCCTCTGAAGTCTCAAAAACAAAACAAGGAAAGGGGGAGGAACATTCTAGGCTAAAGAACANAATA
CGTGAAGGTAAAGAATTTTATCTACAAAAAGATAGGAAGTTTGGAGCAGCCAACAGGGGGAATGAAGGACAGGCTANTGG
GGACAGGGCATTGGCCAN
Sequence Type genomic DNA
Unitrap ID UNI10917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89534075..89534331 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027951 (Adar) NM_001038587 adenosine deaminase, RNA-specific Gene [Source:MGI (curated);Acc:Adar-005]


Sequence tag IST10439A3BBF1
Sequence
TGGGCATCTANTGTATGCTACAACGTCAGCACCCANCAGCACACACAGTGTAAGTAGAAGCCCCAGCATGTAGCAGTCTG
GGCAAGATGGATGGCTCAAAAGTCACTCCCAATCATGTCCTCCCTGTTTGGTATAGCTGCCTGCCTTCAGTGCTCCCGGG
GGCACTCCAGTGGGCAGGGCTGTTCTCGCCTATATCCCCTGCACAGTGAGTCCCANACAGTCNTAGGTGAGTGGATAATA
GTGCACTCTAANTAAAACNNTNNGNGGAACANAAACTTGGGGGGGGGGNNAAAAAAAANGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027951


For any suggestions or comments, please send an email to unitrap@crg.es