Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14980E10
Clone ID IST14980E10
Vector VICTR76
Project tigm

Sequence tag IST14980E10BBF1
Sequence
GTTGTATCTGAAGACTACACAAGTAGCTTGCTTGCCTTCCTTCCTTCCTTCCTTCCTGCCTTCCTTCCTTCTTTCTTTTC
TTTATGGTTTTTTGTTTGTTTGGTTGGTTGGTTGGTTGGTTTTTGTTTTTCNAGACAGGGTTTCTCTATATAGCCCTGGC
TGTCCTGGAACTCACTCTGTANACCAGGCTGGCCTCGAACTCANAAATCCACCTGCCTCTGCCTCCCAAGTGTTGAGATG
AATGTTATCCANGTAACTTTCTGACCNCAGGANTTCCTGGGGTANNAAAAATGGCTCANAAATATGGTAAATGTTCANGG
AAAAAAATAANCNANACCACAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62265922..62266263 316
 
EST/CDNA Est Name
  BG146304.1 - BY311284.1 - CJ126395.1 - CJ175513.1 - CJ125811.1 - CJ130245.1 - CJ178809.1 - BE647957.1 - BP753711.1


Sequence tag IST14980E10HMR1
Sequence
NACCTGTGTCCTCTACCCACTTGCCTTTGAAAGTCAGAGACATGGCAAGCACACTGATGTGTGCCTGTGTAGTTCTTCAG
TTTAATACCTTATTGTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62265825..62265923 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


Sequence tag IST14980E10HMF1
Sequence
GTTGTATCTGAAGACTACACAAGTAGCTTGCTTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62265922..62265956 35
NO GENE  

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es