Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_202.1G4-3
Clone ID CMHD-GT_202.1G4-3
Vector pGTlox4
Project cmhd

Sequence tag CMHD-GT_202.1G4-3
Sequence
AAGGGGCCACAGAAGATCTAACTGTGCGAAGTTTTCCAGTAGCATCCATGAAAAAACACTGCCCCAAGACTCGGCTCTCG
GTACTGATCCAGGACCCGACTTTTGTCCTGATCCTGGTACTGGGCTCCAGAGTAACAAATGTGAAGCCTACGGAAGCAAG
ACTCAGAACTCCCAGAGAGTCTGTGAGGAAGACCCACCAAAAGAATTTTATTATAGATATAACACTCCAGGACAAGATGA
CTTACAATCATGCTGGAGGATATATCGTTGTCCAGCCTCACTTCTTATATGATAATATTATCTCTGCATCTTGTAAGTAC
Sequence Type mRNA
Unitrap ID UNI13898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 108574846..108578219 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049565 (4921525H12Rik) RIKEN cDNA 4921525H12 gene Gene [Source:MGI Symbol;Acc:MGI:3584453]

 
Come back to gene ENSMUSG00000049565


For any suggestions or comments, please send an email to unitrap@crg.es