Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15024B12
Clone ID IST15024B12
Vector VICTR78
Project tigm

Sequence tag IST15024B12HMR1
Sequence
NCTGTAGGCAGTTGGGTAATGACCTTAAACTTGTGTGCTTACAGCTACAAGAAAATGTGTATTAGCAACCTGTTCAGAGG
GGTGACCTCTGCATTGCTGTGGGAAGACAGAGGAGTGTTCCTCCCTTGGTGACTCACCAGGCAGGGCTACCGTTTTGTGT
TCAGGTTTGGCGACTTTGATGTAGTTACAGTAAGAATTTTGGCTACNATCAGTTCATACATTTTANCAAGGTCTACTTCT
AGGACTTGCATGTGGTGCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI29651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42269623..42269883 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037287 (Tbcel) NM_173038 tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]


Sequence tag IST15024B12HMF1
Sequence
ACAGCCTCTCTCATTATTATCTCTGAGCTGCCATGAGAAGGCCCGGTCTCATTAGGAACAGACGCTAAACCTATCACCCA
GCAGCCTTCCGGAGATAACAAAGCACTCTGATAACCAGGGGTCGCCACGTGTTACAACAGCCCGGACAAAGTATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42269880..42270038 159
NO GENE  


Sequence tag IST15024B12BBF1
Sequence
ACAGCCTCTCTCATTATTATCTNNNANNTGCCATGAGAAGGCCCGGTCTCATTAGGAACAGACGCTAAACCTATCACCCA
GCAGCCTTCCGGAGATAACAAAGCACTCTGATAACCAGGGGTCGCCACGTGTTACAACAGCCCGGACAAAGTATGGCCAA
GTTTACACATGGAAACAGTCAGCAGCTCCTTCCAGTCCCCCGCCACAGCACTGCTGCTGATGGCAGAGTGTGCTGACTCC
AGAACTACGCTGCTTGTAGCTGATGATGAGAGTCTACCATCCCTGTGGCTGCAGTCAAGCTGCAGAGCTCCGGGAACTGC
TGGAGGACGCATGGAGCAGTTAGCACTGANATGCCAGTGCCNNNTCCATCTACTACCCGACCACTACCTACCATCAACTC
TGANTGACCNCNNAAGTGANTGTACTGGGCTGCNTGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42269880..42270317 408
 
EST/CDNA Est Name
  CX731519.1 - BB627885.1 - BB616369.1 - BU505316.1 - BB659669.1 - BE911979.1 - BB847425.1 - CJ184554.1 - CJ184895.1 - BY129926.1 - BY153129.1 - CF538084.1

 
Come back to gene CX731519.1 - BB627885.1 - BB616369.1 - BU505316.1 - BB659669.1 - BE911979.1 - BB847425.1 - CJ184554.1 - CJ184895.1 - BY129926.1 - BY153129.1 - CF538084.1


For any suggestions or comments, please send an email to unitrap@crg.es