Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14773D7
Clone ID IST14773D7
Vector VICTR76
Project tigm

Sequence tag IST14773D7HMR1
Sequence
NNTTTNAAAATCTATCACNAAGANTCCAAAGACCCAGGCTTAAAATTCTTTCAGTTTGCCTGCTTACTCGTGATCTTTTG
ATGCTCTGGCACAATATTCATAATGTTCTTCATATAAGCATAATGCAGAAAGGGATCAAAAGTCCAAATTCTAACCAAAT
ACCTATGAGCAGAATTAATACCCAGGAAGACGTTCTCGCAGAAGTCTTAAAGCCCAATTGAGTCTACCTATAAAAAGGCT
TACCCTAGAGCTCAGAGACCACCCTTCAAAGTGCAAGAGGAGAGAGAATGTCNGTTCTCGTGTACTCCCACACACNAATG
GTCCCATATTGTCTCTTTAGAAGCAAGTCCCATGTN
Sequence Type genomic DNA
Unitrap ID UNI27652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8537958..8538310 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027500 (Stmn2) NM_025285 stathmin-like 2 Gene [Source:MGI Symbol;Acc:MGI:98241]

 
Come back to gene ENSMUSG00000027500


For any suggestions or comments, please send an email to unitrap@crg.es