Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14913E6
Clone ID IST14913E6
Vector VICTR76
Project tigm

Sequence tag IST14913E6HMR1
Sequence
ACAACCNTCTGTNNTGGGATCCNNTGCCCTCTTCTGGTGTGTCTGANNACNGTGACNGTGTACNCATATAAATNNNATAA
ATAANTAANTCTTTTAANAAAGAGAGACAGANGGAAGGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14913E6HMF2
Sequence
GTTGTGAGTCACCAAGTGGTTGCTGGGAATTGAACTCAGGATCTCTGGAAGAGCAGTCGGTGCTCTTAACCGCTGAGCCA
TCTCTCTAGCCCCCTCTTGGTCTTTTCTTTACTTACTACACTTTATTTCCTTGTGTTGCGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTG
Sequence Type genomic DNA
Unitrap ID UNI33308

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29329676..29329852 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024008 (Cpne5) NM_153166 copine V Gene [Source:MGI (curated);Acc:Cpne5-001]


Sequence tag IST14913E6BBF1
Sequence
ACAGAACAGATATTTTCCCTTCTGTTCAGTACTGACCAGGGAGGGAGACTTTAAAAGTTTTCCCCGAGGTTCTTTTAAAA
GAGATTAAAGACAGCTGCTAAAAAGATTTCCTTTGTCATCCAGTCAGTCCCAGAAATTTTTTTTTTCCAAAATAGGGTTT
CTGTGTATANCCCTGGCTGTCCNGGAACTCACTTTGTAAACCAGGCTGGCCTCAAACTCAAAAATCCACCTGGTTCTGCC
TCCCNAANGCNGGGATNAAAGGCNNGCNCNNCCNCNCNNANCANTCNCCCNNGGANGGNNTTNCAAANACAANNTTTGGA
NCNNANACAAAAGGATGGACCATCTANANACTGCCNTATCCNGGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024008


For any suggestions or comments, please send an email to unitrap@crg.es