Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14356E12
Clone ID IST14356E12
Vector VICTR74
Project tigm

Sequence tag IST14356E12HMF2
Sequence
AACTGACCNAGGGGGCTAAGGACTGTGTTGCTATCACTCTGTCTTATTTTANATGGCCCTATGCATTGCTGAATGGCAGC
TAAGTTTGGCAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101494748..101494857 106
NO GENE  


Sequence tag IST14356E12HMR1
Sequence
TGAACCCAAAGANNAAGGTCCTAAAAACCNCTCTATTTCAGATNNNNNAGCCCTTACCNNNNTNATAAGAGAAATANNNT
CCNTCTACCAACCTCTGCCNNNNTATGTCTAGGATGAAAAACTAAATAAATTATTCGCTCCTCCTACCCCTCCCTCTCCC
ACTCAAGGGCAAGACTCCATTAAAAAAACATAGGAGCTACTGCCTGCCTCTCCCTTAATTTCCCTCCCTCCATTCAACCA
GAGAGAGGCATCTCTCCTCCCCCTTCTCCAAGCCGGAAAAGCAAAACACCTTCCAAACTCACAGCCAAAGCCCCACCTAA
CTCCATTGTTCCTTACCCCATCNTCTGTCACCCAACAGCTTTTTAATATTGGAGACTCTTGCNAAAACTAACCCNCACNT
NNNATTCTACTCANGAGCCTGATACNNNACTAANAANCCCAANNCGCTCAAGCATTCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14356E12BBF1
Sequence
TGATTACAGTTGTAATATTGCTTAGATATTGTTTTCTGGGCTAAGAGTTATACAGCCATATAACATTTTGAGTTTTCTTT
CAAGTGGGATTGAGTATTCTAGGGTCTGCTCGTAAACTGGAGACCTCAGAAGTGCATGGTCATCTTGGCTGTATGATGAA
ATCAGGTTAAGAGCACCACTGACTGCTCTAACAGAAGTCCTTAGTTCCAAATTCCCAGCAACCACATGGTGGCTCACAAC
CATCTGTTTTGGGAGCCCTCTTCTGGTGTCTGAAGACCGTGACCNTGCNCTCACATGTAGAAAATAAAATATTAAAAGTA
TCTGANGTATGAGGGTATGACTAGCCTAGTAACAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI33912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 55972263..55972622 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022601 (Rpl24) NM_024218 ribosomal protein L24 Gene [Source:MGI (curated);Acc:Rpl24-005]

 
Come back to gene ENSMUSG00000022601


For any suggestions or comments, please send an email to unitrap@crg.es