Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12803B4
Clone ID IST12803B4
Vector VICTR76
Project tigm

Sequence tag IST12803B4BBF1
Sequence
ATGGCATTTCTACCAAATGTGATTTATCAATTGTAGTTGTATATTCTTCATATCTAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI29790

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11843741..11843802 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]


Sequence tag IST12803B4HMF1
Sequence
ATGGCATTTCTACCAAATGTGATTTATCAATTGTAGTTGTATATTCTTCATATCTAANATCTCAGAAAGGGTAGAACCAG
GTTTTCCAACTTGAGCAATATCAAGTATTGATGGAAACCGATTCTTTTTTGGCTAAAGACGGAGCTCTGTGCATTGTAGG
TCTCTCCTACAAGATGCCCCCAATCAGTGGAGACAGTCAAAAATGCCTCTAGATGTTTCCAAATGTCCTCTAACATCAAA
GGGTAANAAATTTCCCCTTCANTANACAACTCTCAGTTCTAAGCCTGTTCAAAGTCTGTCATCAGACTGGCAGGGTATAA
GCCAGCCGTGAAAGGAATACTTTGAATGTGTTNAAATANTGAGATTTCTAGGTGTGGTACGCATGCCTAGAGTCCNANCA
NTTANNGGGAANAANACTGTTGANTTTCNNNCCNNCTCNNACTTTNCNCAGAAACCCTTTCTTNAAAAAAGAAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020176


For any suggestions or comments, please send an email to unitrap@crg.es