Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_194B11-3
Clone ID CMHD-GT_194B11-3
Vector pSD5*
Project cmhd

Sequence tag CMHD-GT_194B11-3
Sequence
GTTTCTTCCATGCTCCGTAGGATTCCTAGATCTTATGTTGGTGAGGAGCCCTCTCAAAGAGCCACAGCTCAAGAACTCCT
TGGACATCCATTCTTAAAATTGGCAGGTCCACCATCTTGCATTGTTCCTCTCATGAGACAATACAGACATCACTGAGAGG
ATTCACACAGGATGCAAAAGCTAGGC
Sequence Type mRNA
Unitrap ID UNI13904

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135908928..135909112 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039913 (Pak7) NM_172858 p21 (CDKN1A)-activated kinase 7 Gene [Source:MGI (curated);Acc:Pak7-002]

 
Come back to gene ENSMUSG00000039913


For any suggestions or comments, please send an email to unitrap@crg.es