Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14836G11
Clone ID IST14836G11
Vector VICTR76
Project tigm

Sequence tag IST14836G11HMF1
Sequence
GTGGTATGCATTCCCATCTATAATCCCAGTACTCCTGTGGCAAAATAGGCTAGTAGAGAAAAGAATTGCCTGAAATTGCC
GGGCCAGCTAGCCTAGGAGTATACAGTATAGCAAGAGAAAAAGAGACCCGGCCTTAACGAAGAGGAAGGAAACACTGACT
CTTGAAAAACTGTCCTCTGACTTCCACATGTGTTTCACACACACACACACACACACACACACACACACACACACACACAC
ACACACACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7745294..7745542 249
 
EST/CDNA Est Name
  BF462074.1


Sequence tag IST14836G11BBF1
Sequence
GTGGTATGCATTCCCATCTATAATCCCAGTACTCCTGTGGCAAAATAGGCTAGTANAGAAAAGAATTGCCTGAAATTGCC
GGGCCAGCTAGCCTAGGAGTATACAGTATANCANGANAAAAAGAGACCCGGCCTTAACGAANAGGAAGGAAACACTGACT
CTTGAAAAACTGTCCTCTGACTTCNANNNGTGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14836G11HMR1
Sequence
TTTGAGGCTANAANTCAGGTCACTGGACTTGANCCATCTCACTAGCCCACCCCTGGCTTTANCCTGCAGCANAGATACAA
ACTGTTATACTTATACCGCAAGTGCTTCACCAATTCAGCCAACTTCCCAGGGCCTATTCTTATTTAACTGAATTAATTTG
TCATTTTAATTTGTCTCCATTAAAATGCTAAGGAGAGGACTAGGTGTGGTAGCACATGCCTTTAATCCCAGCACTCGGGA
GGCANAGGCNGGCGGN
Sequence Type genomic DNA
Unitrap ID UNI19866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7745027..7745281 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039201 (Tbc1d25) NM_172478 TBC1 domain family, member 25 Gene [Source:MGI (curated);Acc:Tbc1d25-001]

 
Come back to gene ENSMUSG00000039201


For any suggestions or comments, please send an email to unitrap@crg.es