Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12077D9
Clone ID IST12077D9
Vector VICTR76
Project tigm

Sequence tag IST12077D9BBF1
Sequence
ATCCCCATTTGAAGTAATATGCACAGAGAGGTGATACCACTCCGACAAGGTTACATGGCCACGAAATGGGTCATAAGCTG
GGATTTGAACCCATTTACATATTTAAAAATGTTTAAAATGACACATATTTATTTATGTTGGACTTGGAGCATGCATGTGT
GGTCAGAGGACAACTTGCCTGAATCCATATTGTGCAAGCATGTGGGTCCCAGGGATTAAACTCAGGTAGAGAGACAGGCT
TGGCAGCACGTGTCTTTACCCCTGANCTGTATCATTGGCCCCCAATTGTATCTTTTTGTGTATGCCCCTTGTGTGCATGT
GCATGCGTGGAAGTCACAGGTCAATGTTGGGCATCCCATAAAATGAGATAAAAATCCTAAGTTGGCTTTATGGGTTTGCT
GNGTCTGGCCNNNCAGCNNCNNGCCCTGTTTTTTNTTCCAANGTGTGCCNNCNCNGGCCTTN
Sequence Type genomic DNA
Unitrap ID UNI32855

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81108107..81108566 427
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054708 (Ankrd24) NM_027480 ankyrin repeat domain 24 Gene [Source:MGI (curated);Acc:Ankrd24-001]


Sequence tag IST12077D9HMF1
Sequence
ATCCCCATTTGAAGTAATATGCACAGAGAGGTGATACCACTCCGACAAGGTTACATGGA
Sequence Type genomic DNA
Unitrap ID UNI32855

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81108107..81108164 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054708 (Ankrd24) NM_027480 ankyrin repeat domain 24 Gene [Source:MGI (curated);Acc:Ankrd24-001]

 
Come back to gene ENSMUSG00000054708


For any suggestions or comments, please send an email to unitrap@crg.es