Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12841G10
Clone ID IST12841G10
Vector VICTR76
Project tigm

Sequence tag IST12841G10HMR1
Sequence
AGGTCNGCTAGAGAGCCTCATCTCCTTGGGCCTGGGGAAGCTCGCTCAGTGAGGACAGTATGTACTTAGCATATAAGAGA
GCCTAGGTTGGATCTTANCATTAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI16274

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24330513..24330623 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036473 (Tbc1d24) NM_173186 TBC1 domain family, member 24 Gene [Source:MGI Symbol;Acc:MGI:2443456]


Sequence tag IST12841G10HMF1
Sequence
ACCTGACTCTCTGGTAGTCTGTCGGCTGGCTGGCTTATGTCACACAGNCTTACAAACCACACTCCTCAGACATTGTGTGG
TGTGGTCAAGGAGAGAGGGGAGAGGTAGGTGCAAATGAGGCTAGCAAGCCAACTAAGAAGTCAGGCAGGCTTGTCTTCNA
GGTCCAGACTTANCTTCTTGGGCCAAGCCTCCCATCCCCACAAGGTAGTGGCTTTGTGGGAAACTGCAATAATAGCTAAC
ACCCACCCTTAGAGACACTGGCTCTCAGTAACACCTTTGANTTGAGTACTGCCTCTGGGCTTGCTGGGTGGGGTGACGTT
AGGGTGANACAGCACATACCCTGCACANNCNCTGCCACTTTGAAAGGTGCTCTTGANAANTCACTTTCCCTCANCCTGGG
GGCTGTGANTTGTCATCATANACACTGCGCTGCTGCATTGTCTCAAANTCCCTCTGTGCACCCTNNANTTCTCACCCNAN
AANAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24330620..24331101 444
 
EST/CDNA Est Name
  BY467107.1 - BB633011.1 - BB655710.1 - CN698944.1 - BB628796.1 - BY726684.1 - BB662801.1 - BB652809.1 - CJ123173.1 - BB659310.1 - CJ120077.1 - CJ111145.1 - CJ124986.1 - CN698874.1 - CJ108320.1 - BB651937.1 - CJ113294.1 - CJ127605.1 - CJ113360.1 - CJ113218

 
Come back to gene BY467107.1 - BB633011.1 - BB655710.1 - CN698944.1 - BB628796.1 - BY726684.1 - BB662801.1 - BB652809.1 - CJ123173.1 - BB659310.1 - CJ120077.1 - CJ111145.1 - CJ124986.1 - CN698874.1 - CJ108320.1 - BB651937.1 - CJ113294.1 - CJ127605.1 - CJ113360.1 - CJ113218


For any suggestions or comments, please send an email to unitrap@crg.es