Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14318D4
Clone ID IST14318D4
Vector VICTR74
Project tigm

Sequence tag IST14318D4HMF2
Sequence
TTCTCAGGTCCTCCCTTATCTCCCTACCCACCCAACTTCATCTCTCTTCCTCTCTCTCTCTCAAGGAAAAACAAAAAAAC
CAAACTTAACAACCCCCAAAAAAGANAGGAAGGAAGGAAGGGAANAAGGGAAGAAAGAAAAATATGAAACAAAACAAAAA
GCACAGACACAAAAGGGAGTCCAAACCACCCCANCATGAGGCCCTGTCCTGGANTCACTAAGCCCAGTGACATTTCACCA
GGGAAANNNNNNTCTCCTTCCCCCACAGGTACCAGCTGCAAACANCTTCTTGGTTAGGTANCAATGGGGCTTTGTGGCTC
CCCCTTCTCAACACAGGGATTTGGGGTGTGGCTTGAACCNNTTTTTTTGGGTGTGCANATCTGTGCNTGCTCACANTCNC
NTGTGTGTCNNTCCTGTGGTGTCNGGANNANGCTGTNNCNNTGANNTCANCCNCACACTTNANANCCGNTGNNNACNCNA
NANNNGNCNCNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14318D4BBF1
Sequence
TTCTCAGGTCCTCCCTTATCTCCCTACCCACCCAACTTCATCTCTCTTCCTCTCTCTCTCTNNNGGAAAAACAAAAAAAC
CAAACTTAACAACCCCCAAAAAAGAGAGGAAGGAAGGAAGGGAANAAGGGAANAAAGAAAAATATGAAACAAAACAAAAA
GCACANACACAAAAGGNNNNNCAAACCACCCCAGCATGANGCCCTGTCCTGGANTCACTAAGCCCAGTGACATTTCACCA
GGGAAAACTGGTTCTCCTTCCCCCACAGGTACCANCTGCAAACAGCTTCTTGGTTAGGTANCAATGGGGCTTTGTGGCTC
CCCCTTCTNAACACAGGGATTTGGGGTGTGGCTTGAACCNNTTTTTTGGGTGTGCNNATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14318D4HMR1
Sequence
GGAGGGGAAAGAATATGATCAAAATATATTCTATGAAAAATTTAAATT
Sequence Type genomic DNA
Unitrap ID UNI371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72221217..72221264 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039395 (Mreg) NM_001005423 melanoregulin Gene [Source:MGI Symbol;Acc:MGI:2151839]

 
Come back to gene ENSMUSG00000039395


For any suggestions or comments, please send an email to unitrap@crg.es