Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13977D3
Clone ID IST13977D3
Vector VICTR74
Project tigm

Sequence tag IST13977D3HMF1
Sequence
AGCCCAGACAGCGTCCCTGGAATTTCCTTATTTTGTCACCCGTATCCTGGTGCCTTTGAGACGTTTTCTGAGTGGGTCAA
TTAAAGCAAGCCCTGAAGTCAGTTTAGGCTGTACCCTGTGCAGCGTGGGGCAGATGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI33308

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29327510..29327649 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024008 (Cpne5) NM_153166 copine V Gene [Source:MGI (curated);Acc:Cpne5-001]


Sequence tag IST13977D3BBF1
Sequence
AGCCCAGACAGCGTCCCTGGAATTTCCTTATTTTGTCACCCGTATCCTGGTGCCTTTGAGACGTTTTCTGAGTGGGTCAA
TTAAAGCAAGCCCTGAAGTCAGTTTAGGCTGTACCCTGTGCAGCGTGGGGCAGATGAGTTAACTTCCTCTCCTCCCCTTC
CCACTCCTCCTTCTCCTCATCCTCCTCTTCTTCTTCCTTCTCCTCCTCCTCCCTTTTCTCCTCCTCTTTCTCCTCCTCTG
GANNGTGANAAAACAGGAGTTTTTCAAGTGGAGGTTGGAAAGGTGAAGGGTCCAGGTGGCACCCGACGTCNANGGAGTGC
TTGGTCANTCCCNAATGCCCTTGTTCTGGGCNNGAAACTCTGGGGCTTTCTGGAAGCTCCAGTNNCNTCN
Sequence Type genomic DNA
Unitrap ID UNI33308

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29327267..29327649 365
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024008 (Cpne5) NM_153166 copine V Gene [Source:MGI (curated);Acc:Cpne5-001]

 
Come back to gene ENSMUSG00000024008


For any suggestions or comments, please send an email to unitrap@crg.es