Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14226E1
Clone ID IST14226E1
Vector VICTR74
Project tigm

Sequence tag IST14226E1BBF1
Sequence
ACTCCTGAAAACTCCACACAGGTTAGCCAGTCAACAAACATGGAAAGCACTTTCCAAGAGGATAACAGAGAACATAAAGA
TCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34928184..34928266 83
NO GENE  


Sequence tag IST14226E1HMR1
Sequence
NAGTGAGTTAGATGGAGCTCACTTAGGGACTTCGGCTATCTTTCCATGGGAGTTTANAGCTTACTTAATACATAGGGCAA
GAAAGTGGTCTTCTCTGCCCAAAGGAAGGAGCTTAAGATATCTGTTGTCATTGTTATGTT
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34928264..34928402 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es