Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14939G10
Clone ID IST14939G10
Vector VICTR76
Project tigm

Sequence tag IST14939G10BBF1
Sequence
CTGCCTCTGCCTCCCGAGTGCTTGGATTACAGTACTCAAACTGGGAGAAATCTGTAACTTTAATTTCTTTTCTTTTCTTT
CTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120710409..120710501 93
NO GENE  


Sequence tag IST14939G10HMR1
Sequence
GCAGGAGGGTCCCAGAGCAGATCATCCTGCTCTACAGAGTAAGTTCTAGAGAAACCCTGTTTNAAAAAACCAAAATAAAT
AAATAAAA
Sequence Type genomic DNA
Unitrap ID UNI12986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120710325..120710412 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048445 (Ccdc57) NM_027745 coiled-coil domain containing 57 Gene [Source:MGI (curated);Acc:Ccdc57-001]


Sequence tag IST14939G10HMF1
Sequence
CTGCCTCTGCCTCCCGAGTGCTTGGATTACAGTACTCAAACTGGGAGAAATCTGTAACTTTAATTTCTTTTCTTTTCTTT
CTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120710409..120710501 93
NO GENE  

 
Come back to gene ENSMUSG00000048445


For any suggestions or comments, please send an email to unitrap@crg.es