Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12441H6
Clone ID IST12441H6
Vector VICTR76
Project tigm

Sequence tag IST12441H6BBF1
Sequence
CTGATTAATACACAGGACTTGCCTCTCAGCTCTGCTGCTGCTGTGGGAAAGCANCTTCANACAAGTGAGCCCTGTTGAAN
GGNCANACNNGACTGNNTTGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12441H6HMF1
Sequence
CTGATTAATACACAGGACTTGCCTCTCAGCTCTGCTGCTGCTGTGGGAAAGCAGCTTCAGACAAGTGAGCCCTGTTGAAG
GGACAGACAGGACTGAGTTGCCAGTTGATCAGTGACTTTTGTTA
Sequence Type genomic DNA
Unitrap ID UNI33252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147528676..147528798 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029001 (Fbxo44) NM_173401 F-box protein 44 Gene [Source:MGI (curated);Acc:Fbxo44-001]

 
Come back to gene ENSMUSG00000029001


For any suggestions or comments, please send an email to unitrap@crg.es