Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10262A6
Clone ID IST10262A6
Vector VICTR76
Project tigm

Sequence tag IST10262A6BBF1
Sequence
CAATGTGCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCNAAAAACCAAAACAAAC
Sequence Type genomic DNA
Unitrap ID UNI30695 UNI30696 UNI30697

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6269298..6269354 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34706010..34706066 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015468 (Notch4) NM_010929 Notch gene homolog 4 (Drosophila) Gene [Source:MGI (curated);Acc:Notch4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5555061..5555117 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 55914251..55914307 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68724065..68724121 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44146667..44146723 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21090181..21090237 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12856278..12856334 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11161848..11161904 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29585573..29585629 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107559269..107559325 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30609823..30609879 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073102 (Gm1060) NP_001028632 gene model 1060, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685906]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 54152649..54152705 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 45789225..45789281 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 105419355..105419411 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 147520210..147520266 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 129942155..129942211 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036086 (Zranb3) NM_027678 zinc finger, RAN-binding domain containing 3 Gene [Source:MGI (curated);Acc:Zranb3-001]

 
Come back to gene ENSMUSG00000036086


For any suggestions or comments, please send an email to unitrap@crg.es