Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_185F8-3
Clone ID CMHD-GT_185F8-3
Vector pGTlox4*
Project cmhd

Sequence tag CMHD-GT_185F8-3
Sequence
ACTAAACCATACACCATTGTTAGCTCGAAGCCCAGGATATTTCCAGGTGATACAATTCTGGAGACTGGAGAAGTAATTCC
ACCAATGAGAGATTTTCCTGATCAACATCATTGAAGAGTCCTTAAAAACTTAACAGACTTGTGTAACAGCACAAGTATGT
TCCCTAAGTGCTGTATTTACTGAATCTGTTTCCTGGAAAAGTAAT
Sequence Type mRNA
Unitrap ID UNI13926

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40217721..40219887 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071014 (Ndufb6) NM_001033305 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 Gene [Source:MGI (curated);Acc:Ndufb6-001]

 
Come back to gene ENSMUSG00000071014


For any suggestions or comments, please send an email to unitrap@crg.es