Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11813H7
Clone ID IST11813H7
Vector VICTR76
Project tigm

Sequence tag IST11813H7BBF1
Sequence
NAGTTGATCTCTTCAGGCTCTTGGCTAAAGATGCGGGAATGAGTAAAATTCATGCTATTTAAGTTTATTATACTTACTAG
TATGTGTGTTTCAGGGTTGGTTTGCCAAGCCTTTCTCCACTGTGCTTANATAGGCAGCTATGGTAACACTGCTATTCCAC
CCATCAATTACTAACTGCTGACAGCTTTTTTTTTTTTNAN
Sequence Type genomic DNA
Unitrap ID UNI7918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101513795..101513990 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061474 (Mrps36) NM_025369 mitochondrial ribosomal protein S36 Gene [Source:MGI (curated);Acc:Mrps36-001]


Sequence tag IST11813H7HMF1
Sequence
GNGTTGATCTCTTCAGGCTCTTGGCTAGAGATGCGGGAATGAGTAAAATTCATGCTATTTAAGTTTATTATACTTACTAG
TATGTGTGTTTCAGGGTTGGTTTGCCAAGCCTTTCTCCACTGTGCTTAGATAGGCAGCTATGGTAACACTGCTATTCCAC
CCATCAATTACTAACTGCTGACAGCTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI7918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101513795..101513989 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061474 (Mrps36) NM_025369 mitochondrial ribosomal protein S36 Gene [Source:MGI (curated);Acc:Mrps36-001]

 
Come back to gene ENSMUSG00000061474


For any suggestions or comments, please send an email to unitrap@crg.es