Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14972B6
Clone ID IST14972B6
Vector VICTR76
Project tigm

Sequence tag IST14972B6BBF1
Sequence
AAACAAAGGGGGCAGTACGCTTGCCGAAACGTTCAGGATAGGGACTCGAACCCTCAAATAATTGTGAGGCCCCTCTCTTT
TGTGCAAAAAGGACCACGGCATCTTTATAAAGACCCCTGGAAAGGATTCTCGGTCCTTTAAGCCGTCCGGAGCCAAGGAC
CGTTGGATGACGTCACTGGCCGGCACGCAGGAAGTGGGAAGAGTTACGAGCCGCGTGGCACCGGAAGTTGGCCACGTAAA
GTCCGTCCTCTTTGCGTCTCCTGCACGGAAGTGAGCGGTGTGCGCCGGAAGCGAATACAAAGGCTGCCTCGTGGGGAAGC
AGGCANCATGGGGCANTCCGGGCGGGTGAGGCNCGGCGGCCTGGGCNGGNNTN
Sequence Type genomic DNA
Unitrap ID UNI33921

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20692417..20692785 359
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004100 (Ppan) NM_145610 peter pan homolog (Drosophila) Gene [Source:MGI (curated);Acc:Ppan-001]


Sequence tag IST14972B6HMF1
Sequence
AAACAAAGGGGGCAGTACGCTTGCCGAAACGTTCAGGATAGGGACTCGAACCCTCAAATAATTGTGAGGCCCCTCTCTTT
TGTGCAAAAAGGACCACGGCATCTTTATAAAGACCCCTGGAAAGGATTCTCGGTCCTTTAAGCCGTCCGGAGCCAAGGAC
CGTTGGATGACGTCACTGGCCGGCACGCAGGAAGTGGGAAGAGTTACGAGCCGCGTGGCACCGGAAGTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20692417..20692647 231
 
EST/CDNA Est Name
  CJ084334.1 - CJ078002.1 - CJ077201.1 - CJ075942.1

 
Come back to gene CJ084334.1 - CJ078002.1 - CJ077201.1 - CJ075942.1


For any suggestions or comments, please send an email to unitrap@crg.es