Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14054A9
Clone ID IST14054A9
Vector VICTR74
Project tigm

Sequence tag IST14054A9HMF1
Sequence
GCTTGCGCTTGTTACTATCGAGATTCTCANAGAGGGGGGCCGCTGCCTCTGCCCTTAACAAAAATGGTCNTCGAGGGAAG
GCGCCTCATCGCGCCGTGAATTATGGCGGCGCTTCCGGTCCCGCTGCCCCCAACAAAGATGGCGGCAGTGGAGAAACGGC
GGCCGGCAGTANCACCAGCGGCCAATTTCCCGGACAGTGGCCGGACGTCGGTGTCTCAGGCGGCNGCGGCCGCTGANAGC
GAGGAGGACTTCCTACGGCAGCTCGGCGTGACGGAGATGCTGCGCGCANCCCTCCTAAAGGTGCTGGAGATCCGGCCCGA
GGAGCCCATCGCCTTCTTGGCGCACTACTTCNAGAACATGGGTCTACGCTCGCCGACCAACGGANGCGCCGGGGAGCCCC
CGGGCCAGCTCCTCCTGCAGCAACAGCGCCTGGGCCGCGCGCTGTGGCACCTTCGCCTGGCTNACCACTCGCAGANGTGC
NGACCGATGGNNGACGGGGT
Sequence Type genomic DNA
Unitrap ID UNI14420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79132053..79132551 473
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020308 (Gtrgeo22) NM_148934 gene trap ROSA b-geo 22 Gene [Source:MGI Symbol;Acc:MGI:106618]


Sequence tag IST14054A9BBF1
Sequence
GCTTGCGCTTGTTACTATCGAGATTCTCAGAGAGGGGGGCCGCTGCCTCTGCCCTTAACAAAAATGGTCNTCGAGGGAAG
GCGCCTCATCGCGCCGTGAATTATGGCGGCGCTTCCGGTCCCGCTGCCCCCAACAAAGATGGCGGCAGTGGAGAAACGGC
GGCCGGCAGTAGCACCAGCGGCCAATTTCCCGGACAGTGGCCGGACGTCGGTGTCTCAGGCGGCGGCGGCCGCTGAGAGC
GAGGAGGACTTCCTACGGCAGCTCGGCGTGACGGAGATGCTGCGCGCAGCCCTCCTAAAGGTGCTGGAGATCCGGCCCGA
NGAGCCCATCGCCTTCTTGGCGCACTACTTCGAGAACATGGGTCTACGCTCGCCNANCNACGGANGCGCCGGGGANCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79132053..79132451 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020308 (Gtrgeo22) NM_148934 gene trap ROSA b-geo 22 Gene [Source:MGI Symbol;Acc:MGI:106618]

 
Come back to gene ENSMUSG00000020308


For any suggestions or comments, please send an email to unitrap@crg.es