Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14331G5
Clone ID IST14331G5
Vector VICTR74
Project tigm

Sequence tag IST14331G5BBF1
Sequence
GGATCAGACCTCTACCTTCACCCATGAGGCTTGCTTGCAGCAATTAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI30820

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166450: 43744..43796 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166477: 48619..48671 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166455: 36182..36234 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 1396..1448 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 154075..154127 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 107708..107760 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079193 (AC133103.5-208)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166415: 444256..444308 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166371: 108765..108817 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161911: 593454..593506 53
NO GENE  


Sequence tag IST14331G5HMF2
Sequence
GGATCAGACCTCTACCTTCACCCATGAGGCTTGCTTGCAGCAATTAAGATCTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI30820 UNI32315 UNI33923 UNI33924

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6683132..6683188 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 14367347..14367403 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5264569..5264625 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 19567919..19567975 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8667023..8667079 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052551 (Adarb2) NP_443209 adenosine deaminase, RNA-specific, B2 Gene [Source:MGI Symbol;Acc:MGI:2151118]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 17772963..17773019 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3313037..3313093 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3823178..3823234 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 9387283..9387339 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3218891..3218947 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 35153400..35153456 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20108166..20108222 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 7835864..7835920 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 16291222..16291278 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 17190468..17190524 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028780 (Sema3c) NM_013657 sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C Gene [Source:MGI Symbol;Acc:MGI:107557]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 19726381..19726437 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4241661..4241717 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5531611..5531667 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3294318..3294374 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161911: 593450..593506 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 107704..107760 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079193 (AC133103.5-208)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 1392..1448 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 154071..154127 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166371: 108761..108817 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166415: 444252..444308 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166450: 43744..43800 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166455: 36178..36234 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166477: 48619..48675 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12836677..12836733 57
NO GENE  


Sequence tag IST14331G5HMR1
Sequence
NCCCCAGTGTGCAAGCATAGGGGCCCTACACAAAACCATCCCTTAGGCTCATCACCCANAGAGGTCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166450: 43679..43745 65
NO GENE  

 
Come back to gene ENSMUSG00000079193


For any suggestions or comments, please send an email to unitrap@crg.es