Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14888A8
Clone ID IST14888A8
Vector VICTR76
Project tigm

Sequence tag IST14888A8HMF1
Sequence
CCATCTCCTTAAGCCTCTGCCTCCTGCTTCCCAGTGCTGAGATTAAAGGAATTCAACACTACTGCCTGGCTCAGCTCTTT
TTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95027533..95027632 98
NO GENE  


Sequence tag IST14888A8HMR1
Sequence
NGGCTCTGTGGGTAAGCCCACCTGTTACACATGCCTAAGAACCTGAGGTCCGATCTTCTGGAGACCGTGAGTTCAGTTCC
CAGCAACCACGTGGTGGCTTACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGGCTTGCAGTCAAACATGCAAAGCA
CTCATACATACAATATATAAACAAATAAACCTTTACTTGCCAAACTCTGGTGGCACAAGCTTTAAAAAGCCAAAAACCNA
ACTGANTTCATCTGGGCAGTGGTGTGGCACACCTTTAATCTCANTACTNANGAGGCANANGCAGGGANATCCNNNTTTGA
GGCCN
Sequence Type genomic DNA
Unitrap ID UNI16036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95027212..95027534 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053192 (Mllt11) NM_019914 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 Gene [Source:MGI (curated);Acc:Mllt11-001]


Sequence tag IST14888A8BBF1
Sequence
CCATCTCCTTAAGCCTCTGCCTCCTGCTTCCCAGTGCTGAGATTAAAGGAATTCAACACTACTGCCTGGCTCAGCTCTTT
TTTTTTTTTTTTTTTTTTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95027533..95027632 98
NO GENE  

 
Come back to gene ENSMUSG00000053192


For any suggestions or comments, please send an email to unitrap@crg.es