Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0138
Clone ID XT0138
Vector pGT0lxf
Project sanger

Sequence tag XT0138
Sequence
GGCTGCAATTGCATGAAATCCCAATGGTGTAGACCAGTGGCGATGGATCTAGGAGTTTACCAACTGAGACATTTTTCCAT
TTCTTTCTTGTCGTCTTTGCTGGGAACCGAAAACGCTTCCGTGAGACTTGACAATAGCTCTGGTGCAAGTGTGGTAGCTA
TCGACAACAAAATAGAGCAAGCTATG
Sequence Type mRNA
Unitrap ID UNI2170

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 76904512..76905104 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022010 (Tsc22d1) NM_009366 TSC22 domain family, member 1 Gene [Source:MGI (curated);Acc:Tsc22d1-006]

 
Come back to gene ENSMUSG00000022010


For any suggestions or comments, please send an email to unitrap@crg.es