Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12656G10
Clone ID IST12656G10
Vector VICTR76
Project tigm

Sequence tag IST12656G10HMF1
Sequence
GTCTTCTGTATTTTGGACTAAATACTAATGGACTAGAGTGCTCCTAGCTTGCTGTAACATTTATGGCAATCGCAAGTTGC
CCTGCTAGGCGGTCTTAATCCGGCATTAACTTATTTTCTATATCCAGTTTAATATGAATCTGGTGTTGATGCAATGCCTC
CGTGATACGTTAGATCTCTAATAAAGTCTGTATATAAATGTACACTTTGATCCTGCTGGAAAATTTTATCAGCGAACACA
TTGTCTAATCTTTCCAAACAGATTTAAGGGAAGGACTTTAAGTACAGGCTGAACATTTGGAAGGCTTAGGGTTTGTTGTT
GTTGTTGTTTGTTTGTTTGTTTGTTTTGGTTTTGGTTTCNTTTTGATTCTNAACTTCNACCTGCTTTTTTTTTGGTTTTG
TTTNANANANTNNNCN
Sequence Type genomic DNA
Unitrap ID UNI7886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91551671..91552073 397
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031665 (Sall1) NM_021390 sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]


Sequence tag IST12656G10BBF1
Sequence
GTCTTCTGTATTTTGGACTAAATACTAATGGACTANAGTGCTCCTAGCTTGCTGTAACATTTATGGCAATCGCAAGTTGC
CCTGCTAGGCGGTCTTAATCCGGCATTAACTTATTTTCTATATCCAGTTTAATATGAATCTGGTGTTGATGCAATGCCTC
CGTGATACGTTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI7886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91551897..91552073 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031665 (Sall1) NM_021390 sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]

 
Come back to gene ENSMUSG00000031665


For any suggestions or comments, please send an email to unitrap@crg.es