Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14185E11
Clone ID IST14185E11
Vector VICTR74
Project tigm

Sequence tag IST14185E11HMR1
Sequence
GCAAGAGTTCTTTTGTGTGTGAGTGCACATGTACAGGTACATGTGGAGGCTGGAGAATAACTCCGAGTGTTGTACACTGT
TC
Sequence Type genomic DNA
Unitrap ID UNI2049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4800570..4800650 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]


Sequence tag IST14185E11BBF1
Sequence
TTGCTCCCATAGACTGAACGTCATGGTGGCAAACACCTGGAAACACAGCTTTGGGAATGCAGAGGTCAGAGGATCACAAG
TTAGGATCAAGCCGGTTTACAGTGAGCTCAGGCAAGCACAGACAATCTCAAACAAACAAAGCTGTGCATGTCAAGGCAAG
GGAGGGAGAAAGAAAGGGAAAAAGAAATTACCCACTAAAAGGAAAACTTAGTTGAACATCAGGTTAGAACTAGAAGGTTA
ATTTGAAGGTTATCAAAGGTGGANGCTGCAAGATATCTGTTAATTCTGTGCCNCCGTTGGATACATCAATGAAATCATAA
TAATAAAAATANNGTAAGANAATAACTGGGGTGGTGANATGGCTCANTGGTTTANNGAACNTTCANCTTGNNNCTNANNN
TGCANGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14185E11HMF1
Sequence
TTGCTCCCATAGACTGAACGTCATGGTGGCAAACACCTGGAAACACAGCTTTGGGAATGCAGAGGTCAGAGGATCACAAG
TTAGGATCAAGCCGGTTTACAGTGAGCTCAGGCAAGCACAGACAATCTCAAACAAACAAAGCTGTGCATGTCAAGGCAAG
GGAGGGAGAAAGAAAGGGAAAAAGAAATTACCCACTAAAAGGAAAACTTAGTTGAACATCAGGTTAGAACTANAAGGTTA
ATTTGAAGGTTATCAAAGGTGGAGGCTGCAAGATATCTGTTAATTCTGTGCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4800282..4800573 290
NO GENE  

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es