Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10118D12
Clone ID IST10118D12
Vector VICTR76
Project tigm

Sequence tag IST10118D12BBR1
Sequence
TTGGGTTCCCATGGCCTGTGTTTTGGTCCAGGTGGCTCAGTGTAATACCTATGTGACCTTGGGCAAGCATCTTGACCTCC
AACCACTTATTTCCTGATGTGTACCTACCTTCTTAGATTCTCCTTGAGGATTAGTGAAATAGCTGAGTTTCAGGGTTCAG
ACAGTGCCTAGCCTATATCAAGAATGAGTGGAAGATTTGGTATGATCATTATCAGAGAAGAGAAGAATGAAACCAACCGG
AGGTGGGATGAGTAGGGCAGAGAGAGCAAACAGAGAAGATAATGAAGCTTACAGGCAGACCTACAGGGTGCATGAGGAGA
CCGGTGGGAGTGTCCTGACACCAGAGTTGGCTTCTTTGTAAGGCCAGTTCTGTGTGCTCATTGACTCCAAAAACAGACTT
TAGCATATCTTCCACTCAGAACCTTCATATATCAATAGAGCTAAGTTTTCTGTAGGGCTAAATAAAGCATTGTCTTTTCA
GCTCTAAAACCTTTTACTTTTTGTTTTTGTTTTTCGAGATGGTTTCTCTATGTAGCCCTGGATGTCCTGGCACTCATTTC
TGTAGACTAGGCTGGTCTCCAACCCGA
Sequence Type genomic DNA
Unitrap ID UNI33926

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106586350..106586935 583
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040813 (Tex264) NP_035703 testis expressed gene 264 Gene [Source:MGI Symbol;Acc:MGI:1096570]


Sequence tag IST10118D12HMF1
Sequence
CCAACAGTCTAACCGCCGTTCACTGACAGTTTTTCCCTCCTCTGGTTTCCAAAAAGGCACTTCATCTTTTGGCCCTCGCT
TATCTCAAGGCTANAAGCTCTCAATATCTAGGCCATAGCCTGTCTTGGGAGTGACAAGCACTGCCACACACTTCTGTTTA
AGGGAACTTANCTCCCAACCTGTCTCTTCCTTCCAA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106586932..106587126 191
 
EST/CDNA Est Name
  CX204035.1 - CX227041.1

 
Come back to gene CX204035.1 - CX227041.1


For any suggestions or comments, please send an email to unitrap@crg.es