Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15002D8
Clone ID IST15002D8
Vector VICTR78
Project tigm

Sequence tag IST15002D8HMR1
Sequence
GTATCTCAGTGGTACAGTGCTTGCTTAACATTGTGAGGATCCAAGTTGAAACTCCCAATACTGCACAAAAGAAGAAACAC
AACTACTTCTGAGTTGTGCTGGTACGTCTCTGCTTTGTAAATTCACAGCTTTCCAAATTTGGGTAAGTGAAAATCCAAGT
TTTACACTGACAGGCAGCTTGTGGTAGGGTTCAAACAAAATGGTTCCCATAAGCAGGTAACAGGTAACTTTTTTTCTTCA
CCTGTTTTCNATTACCTCTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI2331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 60053708..60053978 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026977 (March7) NM_020575 membrane-associated ring finger (C3HC4) 7 Gene [Source:MGI (curated);Acc:March7-003]

 
Come back to gene ENSMUSG00000026977


For any suggestions or comments, please send an email to unitrap@crg.es