Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12816B3
Clone ID IST12816B3
Vector VICTR76
Project tigm

Sequence tag IST12816B3HMF1
Sequence
AACCCTTCCCCACAAGCAAGCTCANATAGGAGCGGANCCTCCCCGGTGGGAGGGAAAGGGGATCTGGCTGGTCCTTTTTG
TTACTCTCTTANGACAGAGGGAGTCCTGACACCCATTTACTGTCTGCTCCTTCAGCCTCCATANTCTGTCAAGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106575490..106575647 150
NO GENE  


Sequence tag IST12816B3HMR1
Sequence
ANCCACTCGAGAGCTGATTCGGAACCTCCGAATTTTTCAGATTAAGAGGATCTGTCTCGCTCCGTCCATCAGAGACTCTG
AAGGAAGAGGCTCAGCCCAGCCCAGGGATTGTGGGTCAGGAAGAAGGCCACAGATTACACTGGCTCAGTCAAAAGTTATT
CCNGTGTGGGAAGACTAGGGATGCTGGGCTGCAGGCATTTTTGAGCTGAANAACGTGACN
Sequence Type genomic DNA
Unitrap ID UNI10799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106575244..106575460 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


Sequence tag IST12816B3BBF1
Sequence
NNNCCTANCCGGGCGTGGTGGCACACGCCTTTAATCCCCANCACTCGGGAGGCAAAGGCAGGTGGATTTCTGAGTTCNAG
GCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAAGGATACACAGAGAAACCCTGTCTCAAAAAACAAAACAAAACA
AAAGAAAAACCCCAAACAAACAAAAAAAGGAGGTGGAGCCTAGTTAGGTGGTGGCTATGCCTTTAATCCCAGCCCTCCCT
CCTGAGGCAAAGGCAAGCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122597193..122597453 255
NO GENE  

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es