Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15068B12
Clone ID IST15068B12
Vector VICTR80
Project tigm

Sequence tag IST15068B12BBF2
Sequence
AGCTCTCCCAATGTTAAATGTTAAAGAAATAAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108004371..108004409 39
NO GENE  


Sequence tag IST15068B12HMR1
Sequence
NGACTTGTAACTCTTTAGCAGTGTTCTCCTGTATTTCTTTAAGTGATTTATTAAAGTCCTTCTTGATGCCCTCTACCATC
ATCATGAGATATGCTTTTAAATCTAGGTCTAGGTTCTCAGGTGTGTTGGGGTTCCCTGGACTGGGCGAAGTGGGTGTGCT
GGGTTCTGGTGATGGTGAGTGGTCTTGGTTCCTGTTANTAANATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGG
AGTTAGTAGTTATAGTTC
Sequence Type genomic DNA
Unitrap ID UNI4014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 100263942..100264197 252
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 33102249..33102504 252
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35520890..35521145 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4621611..4621866 252
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52990810..52991065 252
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 51666590..51666845 252
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 29504203..29504458 252
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 73295803..73296058 252
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 21034377..21034632 252
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 138260783..138261038 252
NO GENE  


Sequence tag IST15068B12HMF1
Sequence
GCCNGTGAGCCTGGAACATACAGTTCAGTGGCAGAAACAAGGGAGACTACTTAAAAAACAAGGTAAAAAGTGAGAAGCAA
CTCCCAAAAGTTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 134116334..134116427 92
NO GENE  

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es