Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14702E2
Clone ID IST14702E2
Vector VICTR76
Project tigm

Sequence tag IST14702E2BBF1
Sequence
AAAGGTTATGAGACCGGTCTCCACGCACCAGGCCTGAGGCTCCAGGGCACTGGCCTATATGTGGCTGCACACCATATCAT
TAAGGTAAGGCCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI31984

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63970142..63970238 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032401 (Lctl) NM_145835 lactase-like Gene [Source:MGI (curated);Acc:Lctl-001]


Sequence tag IST14702E2HMF1
Sequence
AAAGGTTATGAGACCGGTCTCCACGCACCAGGCCTGAGGCTCCAGGGCACTGGCCTATATGTGGCTGCACACCATATCAT
TAAGGTAAGGCCGGATCCTTCTTAGGCTCCAGGAGGGGTCATTGTCTCAGGGGTCACACTGATCCTCTACCACATCAGAT
ATGCTCTCAGTGCCAGCCCACTTCGGCAGAGGTTCTACAGTGGGTACTGTTTATGATCTTANCAAGANGATANGGGACAT
TTGGAAACTTTNTAAACTNNNNGAGGAATCACCNNTGANNGGNNGGGGGNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14702E2HMR1
Sequence
TTTCNNCNNTTNNCTNCAGAGACAGCAATGGGGACCCCAGGATCGCGAGAGACAGCAGGGTACCTCCCTGTCTCCCCATA
TGAAGAAGAGGCTCTACTTACCCGAGGATCACTGAATGTGAGCCAATGCTTCACTCGGTCCCCAAAGACCTCAAAGCATA
GGTCAGCATAGTCACTGAAGTATCGGGTCATACTCACATTCTGCCACCCGCCGTATGCTACCTGGAGCATCTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63969908..63970142 221
NO GENE  

 
Come back to gene ENSMUSG00000032401


For any suggestions or comments, please send an email to unitrap@crg.es