Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0648
Clone ID GC0648
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0648
Sequence
CTTCTTGAATCGCCATGTCAACAGCCAGCCACGGAGCAGCATGCAGAAGCTTTTGATAGTTCTGTGCATTTTGGTCAAAT
AGCTGTACAAGAAGAGTACACGTCTTTTCATATTCACATCTGCTAACTGTACACAGCTGCTCCAGCTGCTGGAACACGGT
AGCAGTGTCATCGAGAGGGTCTTCTAAATTATCTCTCACAACAATGGCAACAGATTCCAAACGGGACGTGATAAAGG
Sequence Type mRNA
Unitrap ID UNI217

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33374887..33378206 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040594 (Ranbp17) NM_023146 RAN binding protein 17 Gene [Source:MGI (curated);Acc:Ranbp17-001]

 
Come back to gene ENSMUSG00000040594


For any suggestions or comments, please send an email to unitrap@crg.es