Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10102B1
Clone ID IST10102B1
Vector VICTR76
Project tigm

Sequence tag IST10102B1BBF2
Sequence
GGCCAGAGATTTAAAGATAACCTAAGTGCACTGAATCCCCTGGATTGGGTTCAATATATTATCCTAAATGCTATTATTAT
CGCCATTATTTTATTAGTAAATCATTGTGTTTCCACCCATCTTCAGAGCACCTCTGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7115712..7115853 140
NO GENE  


Sequence tag IST10102B1BBR1
Sequence
CTGGTACCTGAGGAGGCCAAAAGAGGCTGATGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI33930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96052259..96052295 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070392 (Hist2h3c1) NM_178216 histone cluster 2, H3c1 Gene [Source:MGI (curated);Acc:Hist2h3c1-001]


Sequence tag IST10102B1HMF1
Sequence
CCAGGTAGCCATATGATACATACATATATACATATGTGCAAAATGCATTCATACATATAAATCTAAATTTTTTAAAATTT
AAATGGATTTTCAAGATTCTCCTTCTAGATTGTTACTTAGTGACAGTGAGAAACCTTGCTAAACATGTAATCTTAGACCA
GGGTTGTTGAGGGTGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96052083..96052262 180
 
EST/CDNA Est Name
  BP755546.1

 
Come back to gene BP755546.1


For any suggestions or comments, please send an email to unitrap@crg.es