Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15011B11
Clone ID IST15011B11
Vector VICTR78
Project tigm

Sequence tag IST15011B11HMR1
Sequence
CATCCTGGANCTGGGAAGTGTTTTCNTTTGCCNTGAATAGTCCCATCTACAGGCCCAAANNANNATGCATAGCGTGATTA
ATAAAACCATTCCCGCTGGCTTCCCTCTCANATGATGCAAAAGTGAATATCTTCATGCCTTTCTTTTCCTTTTCTTCCCC
TTTCATTGACCATTTCCTCAAAGAGTTTATTACTTAGCCAAACTGTACTGTGACTTCCTCTGTATTATATTANAACTTTC
CAGAAAGTTGATAATGAAGCTGGGCGTGCTAATCCATTCCCATAAATCCNAAGTTGGGAAGTCGAGGCAGTAGAAACAGG
AACTTTTTAAAGCTGACCTGGGCCGTTGGGACCCTGCCACCCATACATGGGGAAATGTGTCCCTTCATAAAGACTCCTGA
CATAAANTCNAGCGTGGCAATCTAANCTTACATCCCCAGCCAGCACTCACCTANNAGCCAGGTTCGACTGTGCNCATNNG
NAANNNAN
Sequence Type genomic DNA
Unitrap ID UNI33931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 137430299..137430775 443
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019054 (Fis1) NM_025562 Friend virus integration site 1 Gene [Source:MGI (curated);Acc:Fis1-002]


Sequence tag IST15011B11BBF1
Sequence
CATGTGGATGGTGATGGGCCGTGAAACTAAACTTAGCTGGTCTGGGCCCCGAGCCCCTCCCTTGANCCCACGCAGCCTGA
AGTCAGTGGTTAGCTCGCAGGANTGCNCTGCANATCCTCCTGANNNNNNNTCCATTTTTGGTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15011B11HMF1
Sequence
CATGTGGATGGTGATGGGCCGTGAAACTAAACTTAGCTGGTCTGGGCCCCGAGCCCCTCCCTTGAGCCCACGCAGCCTGA
AGTCAGTGGTTAGCTCGCAGGAGTGCTCTGCAAATCCTCCTGACCNGGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 137430169..137430298 128
NO GENE  

 
Come back to gene ENSMUSG00000019054


For any suggestions or comments, please send an email to unitrap@crg.es