Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14459A5
Clone ID IST14459A5
Vector VICTR74
Project tigm

Sequence tag IST14459A5BBF1
Sequence
CACCAATATCGACCCCACAAGGCTCAGGGAACATCAAGGAAGGGGGGGGCAGGTAGAAAGAATGAAAGAGCTGTAGAAGA
GGGTAAAGTCTTGTGAAAGGGCCATCTTCCAGGCATGACATGGCTGTTACTCTCTGCCCCCCGACCCCCATCGGCTGTGA
TTTCCTGCANAANACCTGCACAAGATTAAACCTGTTAACTCTCAGGAGGCCACACTACTTCTTCAAGATTTATACATGGT
TAATGGCTTTCAGGGGAGACGCTCCTGAAAATTGCCCATACTCCTGTAAAAATAATCTCTCGTGCAATCTCCTGTAATCA
AATTCATTGGGTCTTAAAATTTTAAACTAAACAGAAACTACAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109878867..109879235 365
NO GENE  


Sequence tag IST14459A5HMR1
Sequence
GGTGCTGTAGGGCTGAGCATTCAGCACTCACTTCTTCCCAGCAGTTTGACCAGTATGAGTCTGCAGTAATAGCTACCCAT
TGAAAGAAGCAGCTTCTCTGACTAAATATTTAGGGGGTATATTTAGGCAGTTTGACAGGTGTANCATGTCTGTTTATTAA
AACAACAGCTTTAGCTTCCCCACTAGAGCCTATGGGCTTATTTGCCTTAGGCCTTTTACCAGGGTTACAGTACCATGTAT
GGGTTTTCCTCTGTGGAACGGACCNCANATCTTATAACNGTTANGACNNNGTTGCCGGGTAGGTGGGTAGTACANCATGC
N
Sequence Type genomic DNA
Unitrap ID UNI9754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109879232..109879551 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]


Sequence tag IST14459A5HMF1
Sequence
CACCAATATCGACCCCACAAGGCTCAGGGAACATCAAGGAAGGGGGGGGCAGGTAGAAAGAATGAAAGAGCTGTANAAGA
GGGTAAAGTCTTGTGAAAGGGCCATCTTCCAGGCATGACATGGCTGTTACTCTCTGCCCCCCGACCCCCATCGGCTGTGA
TTTCCTGCAGAAGACCTGCACAAGATTAAACCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109879040..109879235 194
NO GENE  

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es