Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14971H10
Clone ID IST14971H10
Vector VICTR76
Project tigm

Sequence tag IST14971H10HMR1
Sequence
AATCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGC
Sequence Type genomic DNA
Unitrap ID UNI1267 UNI6255 UNI30578 UNI30807 UNI31557 UNI33932 UNI33933

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 3375150..3375190 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051951 (Xkr4) NM_001011874 X Kell blood group precursor related family member 4 Gene [Source:MGI Symbol;Acc:MGI:3528744]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4481308..4481348 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019775 (Rgs17) NM_019958 regulator of G-protein signaling 17 Gene [Source:MGI (curated);Acc:Rgs17-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3136726..3136766 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020454 (Eif4enif1) NM_023743 eukaryotic translation initiation factor 4E nuclear import factor 1 Gene [Source:MGI (curated);Acc:Eif4enif1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3563144..3563184 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3337956..3337996 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8770453..8770493 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4385089..4385129 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4180414..4180454 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022521 (Crebbp) NM_001025432 CREB binding protein Gene [Source:MGI Symbol;Acc:MGI:1098280]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3116802..3116842 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3670422..3670462 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3531276..3531316 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3100391..3100431 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4741690..4741730 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3781314..3781354 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3309052..3309092 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4596735..4596775 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3195685..3195725 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3484906..3484946 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040340 (1700019B03Rik) RIKEN cDNA 1700019B03 gene Gene [Source:MGI Symbol;Acc:MGI:1923656]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 5198469..5198509 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_112000: 148590..148630 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 231921..231961 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166283: 26607..26647 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 137056..137096 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 107010..107050 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5518431..5518471 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 318850..318890 41
NO GENE  


Sequence tag IST14971H10BBF1
Sequence
AAGTGAGTTCCAGGACAGCNAGGGCTATACAGAGAAACCCTGTCTCGGAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI35811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10060139..10060199 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6494234..6494294 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79958389..79958449 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3927590..3927650 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70446774..70446834 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14251227..14251287 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 43986927..43986987 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 24239210..24239270 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 22970806..22970866 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44013823..44013883 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54232705..54232765 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 113903204..113903264 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29543007..29543067 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 39454517..39454577 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003134 (Tbc1d8) NM_018775 TBC1 domain family, member 8 Gene [Source:MGI Symbol;Acc:MGI:1927225]


Sequence tag IST14971H10HMF2
Sequence
AAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGGAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 30357..30409 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 10787..10839 53
NO GENE  

 
Come back to gene ENSMUSG00000003134


For any suggestions or comments, please send an email to unitrap@crg.es