Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12435G3
Clone ID IST12435G3
Vector VICTR76
Project tigm

Sequence tag IST12435G3BBF1
Sequence
TTCTCCTAGACTACAGACTGCTCTCTTTTTTGTACAATGATCTTCTGTGTTTCTTTCCCTCCCTCCCATCATCATCATCA
TTTTATTTTTTTAACTATGTAGCTCANGTTGGCCTTGAACTCTTTTTTANANATATTTTANTTANTTTNNGTNNNTGAT
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34935680..34935827 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


Sequence tag IST12435G3HMF1
Sequence
TTCTCCTAGACTACAGACTGCTCTCTTTTTTGTACAATGATCTTCTGTGTTTCTTTCCCTCCCTCCCATCATCATCATCA
TTTTATTTTTTTAACTATGTAGCTCAGGTTGGCCTTGAACTCTTTTTTAAAGATATTTTATTTATTTTATGTATATGANT
ACACACTGTANCTGTTCNGTTGGTTGTNNGCCTTCNNGTGNTTN
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34935680..34935882 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es