Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14890H8
Clone ID IST14890H8
Vector VICTR76
Project tigm

Sequence tag IST14890H8HMR1
Sequence
AACAGAGCATTCAGTTTTCCAGTTGTCCCCATGAACCTGTCACCTGCTCTGGGAACGTGGCATCATACCCCCTTAGTGAG
TGGGGCTCTCATGGCTTCTCACTACAAAGCTTCAGTGCACCTAGAAGGTGACTATGGCTGCTTCCCTTTCCTGGGGGCCA
GTGGTTCTGTGCNNNCNGCTTTCNCNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114314005..114314187 175
NO GENE  


Sequence tag IST14890H8HMF1
Sequence
TGTTCTCCTTTTTGCTTTTTTGTTTGTTTGCAAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAGCTTGCTCTGT
AGACCAGACTGGCCTTGAACTCAGAGATCCACAAGGCATGTGCTGCCACTGCAGGGCTAATCACACTTGAATTTTTATAG
CAGCCTCTTAGTTGACTTAGTTGTCTGGTGGGTCTGCTAGCTTTGTTTCAAGACCTGCCAGCCAGTGACAGCCTGTGATT
GTCAACACCTTTGGAGATGACCATGANTACTAAAGCAGATGCCCTGAGGTGTCTAGATGCAAATGGAACCATCNTTCANG
GCATANGATTTGTAACANAGCCNCC
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114313667..114314008 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es