Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_171D7-3
Clone ID CMHD-GT_171D7-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_171D7-3
Sequence
TATTAGCAAAAGATGGTGGATCGCCTGGCAAACAGTGAGGCGAATACTAGACGCATAAGTATTGTGGAGAGCTGTTTTGG
AGCCGCTGGTCAGCCCTTGACCATCCCTGGGCGAGTGCTTATTGGAGAAGGAGTGTTGACTAAGCTGTGTAGAAAGAAGC
CTAAAGCAAGGCAGTTTTTCTTATTTAATGATATTCTAGTATACGGCAATATTGTTATCC
Sequence Type mRNA
Unitrap ID UNI428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10918280..10918499 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049969 (Plekhf2) NM_175175 pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene [Source:MGI (curated);Acc:Plekhf2-001]

 
Come back to gene ENSMUSG00000049969


For any suggestions or comments, please send an email to unitrap@crg.es