Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14778E3
Clone ID IST14778E3
Vector VICTR76
Project tigm

Sequence tag IST14778E3HMF1
Sequence
GCTTTTGCCTTCTTCTTGGCAAAATGCAGCATCCCAGGGGCTCCAGAATCCTGCAGACTGCCTGTGGCTAGCATGTCAGG
GAGACCTACTTTTGTTCCTGCTTTCTTACAACCTGAATGGTACACACAGGGAGGGCCTCCCAATGAGCTCTGCAGTCACG
GTAGAATTGTGATTCTCTGTCCAGAGACCTCAGAAATGACCTAGCCAATACTTGTTGGAGAGGAGAAAGTTTCAAGACAA
GCAAGACCAACAGTGCAGACACTGAGACTCAGGCCTTACTGCAGTCTCTTGCACTCTTCATCATGCATGGCCTCCCCAGA
TTGCCCCCACCTTAACTAGGTTCCAGATGGTGCTTTCAGCGTAGCTCGGCATTTGCAAAGCCNAGCCCATTTCCCCAACC
TTTCAGACACCATGAGCAGCTGGTGGTACACAGGCCCAAGACAACAGGTCTGCCCAGCANCTGATGATGTGACCCAGTGT
GGTACTGGACTNNNTGCCTCTTAACTAAAAAGANANGGATGCNNCCCCCACCCCCTTCNNNANNTGACNACNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43570107..43570660 522
 
EST/CDNA Est Name
  BG695536.1 - BP753754.1 - BB621479.1 - CJ124602.1 - CJ118376.1 - CJ122866.1 - CJ110189.1 - CJ116225.1 - CJ118320.1 - CJ119897.1 - AI747903.1 - CJ101891.1 - CJ122783.1 - CJ124074.1 - CJ122410.1 - CJ126890.1 - CJ124145.1 - CJ128659.1 - CJ110183.1 - CJ111192


Sequence tag IST14778E3BBF1
Sequence
GCTTTTGCCTTCTTCTTGGCAAAATGCAGCATCCCAGGGGCTCCAGAATCCTGCAGACTGCCTGTGGCTAGCATGTCAGG
GAGACCTACTTTTGTTCCTGCTTTCTTACAACCTGAATGGTACACACAGGGAGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43570107..43570240 134
NO GENE  


Sequence tag IST14778E3HMR1
Sequence
AAGCTATAAGAGGGAGGGTCACGTGATGGGTCNGAGCAGTGCTCAGAAATCCCAGGAAAGAATGGGAGACAAAGAAAAGG
AAAAAACTGACCCCGGAAAAGTAAAAAAACAAGGCAGAGGCGGGGTTGANAAAGAGGTGAGCAGAAACTAGAGGCCCAAG
GCACTTGGAACCANAGAGGCNCANATTCCNNTGGTGCGGGCAGGACAGTGTCCTCAGGTGACACTGCATTTCAGGCCTGC
TATTGTACTCTANNGACCANCTTCTCTCTGGGATGTCTTAAGTGGTCTANACTGGCCCATTTGATGTAAGTAATCTTTCA
CCTTTTGAAATTATTAAATANGACGGACAGCTTACTATTATTTTCTGTCNTGGTGACTCCCTTAAAAATCCTCTCTCTGG
GANNNNGAGGCACTTCGGTGANGGTGTATTCTAATGCTCTGATGCTACTGGN
Sequence Type genomic DNA
Unitrap ID UNI15182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43569660..43570110 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028465 (Tln1) NM_011602 talin 1 Gene [Source:MGI (curated);Acc:Tln1-001]

 
Come back to gene ENSMUSG00000028465


For any suggestions or comments, please send an email to unitrap@crg.es