Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11583E8
Clone ID IST11583E8
Vector VICTR76
Project tigm

Sequence tag IST11583E8HMR1
Sequence
NTTCGAAGAACATCATGGTGGCAGTCCTAGCCNACTTGGCCCTTAGTCTGTACTGAGAACGTTGTTGTAGAACTGCAGGG
TAGAACCCAGCTTCCCAACGCTCTCACAAAATAGCTGAAGCAATCAAGTTAAAGAGAGTAAAGGTTTCTGTAACTCTCCG
TTTTGTGGGTTTCAGTCTGGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI30729

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26641492..26641674 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es